satA [2019-08-28 12:25:35]

streptothricine acetyl-transferase

locus: BSU_40740

pI: 5.83

mw: 20.25 kDa

protein length: 173 aa

gene length: 522 bp

function: resistance to streptothricine

product: streptothricine acetyl-transferase

essential: no

synonyms: yyaR

Genomic Context

categories

• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]

Gene

Coordinates: 4,185,160 4,185,681

Phenotypes of a mutant

• sensitive to streptothricine [pubmed|28842538]

The protein

Catalyzed reaction/ biological activity

• acetylation of streptothricin at the expense of acetyl-CoA [pubmed|28842538]
• acetyl-CoA + streptothricin D --> CoA + H⁺ + Nβ-acetylstreptothricin D (according to UniProt)
• acetyl-CoA + streptothricin F --> CoA + H⁺ + Nβ-acetylstreptothricin F (according to UniProt)

Protein family

• [SW|Acetyltransferase family] (according to UniProt)

Kinetic information

• K_m (streptothricine): 1 M [pubmed|28842538]
• K_m (acetyl-CoA): 107 M [pubmed|28842538]

Structure

• [PDB|3PP9] (complex with acetyl-CoA, from ''B. anthracis'', 35% identity, 57% similarity)

Biological materials

Mutant

• MGNA-B856 (yyaR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1855 NBRP B. subtilis, Japan]
• BKE40740 ([gene|66D38B4C38D6C7299502F2BD5C06102A2FF14F92|satA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATCTCCGCCAATC, downstream forward: _UP4_TAATTGATTATAAAACCTCA
• BKK40740 ([gene|66D38B4C38D6C7299502F2BD5C06102A2FF14F92|satA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATCTCCGCCAATC, downstream forward: _UP4_TAATTGATTATAAAACCTCA

References

Research papers

• 28842538,30658980